Rdbi - database access for R

Rdbi Home Page

Download

Rdbi
RdbiPgSQL

these two packages from http://www.bioconductor.org/repository/release1.5/package/html/index.html

Install

R CMD INSTALL ~/Library/R/ rdbi.tar.gz

or

> install.packages("rdbi",lib="~/Library/R/")

> library(Rdbi)
> library(RdbiPgSQL)
> conn <- dbConnect(PgSQL(), host = "10.10.118.118", dbname = "expression")
> res <- dbSendQuery(conn,"select * from exonarray.probe limit 10;")
> mydata <- dbGetResult(res)
> mydata
        id probesetid coordinates                  sequence crosshybridizes
1   494998    2315101   (917,193) cacgggaagtctgggctaagagaca            TRUE
2  1734213    2315101  (1092,677) acaggggccagaagatgaacaatgg            TRUE
3  4767517    2315101  (796,1862) attaagttacatgcagacaacaggg            TRUE
4  4286427    2315101  (986,1674) tgcctggttgtggtattaagttaca            TRUE
5  5760145    2315102  (144,2250) tcggccgtcgtcttctgcagctctg            TRUE
6   671410    2315102   (689,262) aagtcggccgtcgtcttctgcagct            TRUE
7  4275780    2315102  (579,1670) tccaagtcggccgtcgtcttctgca            TRUE
8  4293462    2315102  (341,1677) tgtgatccaagtcggccgtcgtctt            TRUE
9     5388    2315103     (267,2) ctgtctgtcgacccagctggaggca            TRUE
10 6528805    2315103  (804,2550) ccctgtctgtcgacccagctggagg            TRUE

Functions in Rdbi

Function	Description
dbAppendTable	Appends data to a database table
dbClearResult	Clears resources associated with a query result
dbColumnInfo	Returns type information about a result column
dbConnect	Connect to a database
dbConnectionInfo	Returns a list of connection status attributes
dbDisconnect	Closes a database connection
dbGetQuery	Submit a query string and fetch results
dbGetResult	Fetch results from a query
dbListTables	Lists database tables
dbReadTable	Reads a table into a data frame
dbReconnect	Reopens a connection to a database
dbResultInfo	Returns information about a query result
dbSendQuery	Submits a query string to the database backend
dbWriteTable	Writes a data frame to a database table

Category:R

Homepage
Comments

Hide Comments